Science has had such models for decades Bill.
Your ignorance of basic science doesn’t mean the science doesn’t exist.
1 Like
I am not making a claim here. I am asking you to support your claim.
That’s completely false. Let’s revisit the opening post:
SO WHAT IS THAT DIFFERENCE???
You CLAIM that there is a difference, so what is it???
2 Likes
This sure looks like a claim to me
Well Bill? What is the difference?
1 Like
One benefits the organism for survival. This can be trivial. The other creates an innovative new feature like wings or eyes. This is not trivial and can involve millions of coordinate changes. One you can model the other is much more challenging.
It is the difference of flying 100 feet off the ground versus flying to another planet in another solar system.
So… AGAIN you are arguing about Evolution without benefit of God? What exactly is your problem, Bill?
What is the point of arguing about a hypothetically Godless operation when YOU, ME, JOSHUA, and the goals of this site are to argue about God RUNNING Evolution?
Are you some kind of trouble maker?
Or are you with the program? If you aren’t with the program, there is a better room we can put you in - - reserved for people who just want to break things and argue about irrelevant topics…
What say you?
What you call “innovation” occurs due to the simple accumulation of the individual beneficial mutations. We have substantial evidence that’s how eyes evolved, that’s how flight evolved.
You’ve seen models of the process too many times to count Bill. Your Dory defense doesn’t work any more.
1 Like
George, I am talking about identifying an innovative mechanism. Genetic recombination is a possibility.
1 Like
Bill ignores the effects of selection feedback yet again. 
There’s no cure for such willful ignorance.
3 Likes
Do you have any doubts at all that God can’t arrange for the innovative mechanism?
If you don’t have any doubts, then you are just arguing with Atheists for the fun of it, right?
Are you trying to stop science?
Wings and eyes don’t benefit the organism?
What is different about the processes that produce beneficial mutations and the processes that produce innovative mutations? Are they different mechanisms?
Let’s say I we start with this sequence:
AGCAGTGATCTCCCGCGTGCGAGATAAAAATACTAGGTAACTAGAGGGACTGCGACGTTCTAAACGTTGGTCCGTCAGAAGCGCCATCCAGGATCACGTTACCCCGAAAAAAAGATATCAGGAGCTCTCCTCCTCTGCAGTCAGGTCTATAGAAACTACAGGACTAACCTTCCTGGCAACCGGGAGGTGGGAATCCGTCACATATGAGAAGGTATTTGCCCGATAATCAATACTCCAGGCATCTAACTTTTCCCACTGCCTTAAGCCGGCTTGCCCTTTCTGCCTGTAGATCCATTGGACTGGTGCCAACGCGCAGGCATAGTTCGAGGAGAATTATCCGGGGGCAATGACAACCAGCATCTCGGGTCTTGCCCAACCCGTCTACACGCTGTTATAGCGAATCAGCGGGAACCCGGTGCCACGCGATGGAACGTCCTTAACTCTGGCAGGCAATTAAAGGGAACGTATATATAACGCAAAGAAGCTGGAAAATTGGCGAGA mutation occurs in the 5th base of the sequence and nothing happens. Phenotype doesn’t change at all.
After that, a mutation occurs at the 10th base and it produces an innovative feature. This mutation occurred through the same mechanism that produced the mutation at the 5th base. So what is the mechanistic difference between these two mutations?
1 Like
Bill Cole, destroyer of Irony meters. 
3 Likes
Genetic recombination is mutation.
2 Likes
What the heck does that mean? When God engages evolution, he is using natural laws (as described by human understanding embodied in the sciences).
So… there is a complete Unity between God’s actions, the results, and the value of Science.
It would seem, that in the face of all this … you are going WAYYYYYYY out of your way to find people who don’t believe in God so that you can argue with them - - - while at the same time REJECTING natural laws created by God … because you favor God using nothing but miracles.
So … I would ask you to STOP IMPUGNING GOD’s natural laws. Do you think you possibly could stop doing it?
Nicely put!, @Timothy_Horton .
I agree. Art Hunt showed how is created an adaption in plants. Can it innovate? The key is to really understand how it works.
And until then… do you think you can accept that God knows how it works, and indeed, he has made it work over and over again in Earth’s history?
Can you show us the generation before and the generation after an innovation emerged, and show us the genetic differences between them?
1 Like
This is a discussions about evolutionary mechanisms. You are in left field.
We know how it works Bill. Innovations occur through the accumulation of beneficial mutations. Reality won’t change no matter how deeply you stick your head in…the ground.
1 Like