SFT: Is Genetic Diversity a Problem for a Literal Adam and Eve? Joshua Swamidass and Biologos Debunked

[T_aquaticus]

@SFT

Mutation and chromosome crossing-over events are the most plausible cause of these variants.

How can you get that many mutations and crossing-over events in just 6,000 years? Where is the evidence that this many variants can be produced in such a short amount of time?

[SFT]

@T_aquaticus

how all of the current human genetic variation could arise in just 6,000 years with a severe genetic bottleneck 4,000 years ago, and what is the evidence that supports their conclusions?

You’ve proven my point. This discussion has no longer become profitable. I am glad it took place though and wish people coming across it start from the top and read through it all objectively to see just how badly the evolution side is failing to actually address the arguments and to counter the data.

[evograd (Blogging Graduate Student)]

@SFT

I have also yet to see any testable predictions coming from anybody criticizing the young earth creation model here.

You consistently ignore already-confirmed predictions, why do you think we should be impressed by a few untested predictions coming from creationists?

[SFT]

@evograd

why do you think we should be impressed by a few untested predictions coming from creationists?

Clearly you have not yet read Dr. Jeansons newest papers testing the Y chromosome data in regards to the history of civilization.

Provide me future testable predictions on molecular clocks (Y chromosome, mtDNA), and also provide me testable predictions on DNA function. Predictions you would be willing to put in print and test in the lab.

[T_aquaticus]

@SFT

I am glad it took place though and wish people coming across it start from the top and read through it all objectively to see just how badly the evolution side is failing to actually address the arguments and to counter the data.

Assertions aren’t data. You have yet to present any data demonstrating how current human genetic variation could arise in just 6,000 years. You have just asserted it. We need to see mutation rates, population dynamics, and maths. Assertions aren’t going to do it.

The problem is that you can’t have all the variants in one allele. Many of these variants are rare, and they are found separately from one another. If they are on one contiguous stretch of DNA they will travel together, but that’s not what we see. These variants are travelling separately. 200 to 300 generations is not enough time for hundreds and even thousands of recombination events to happen in one gene. The rate of recombination is about 1 cross over event per chromosome per generation. That would be 300 cross over events in 300 generations per chromsome, and each chromosome has millions of bases.

[evograd (Blogging Graduate Student)]

@SFT

Clearly you have not yet read Dr. Jeansons newest papers testing the Y chromosome data in regards to the history of civilization.

Clearly I have. You should spend some time exploring the threads on this forum before trying to rehash points that have already been discussed at length.

@SFT

Provide me future testable predictions on molecular clocks (Y chromosome, mtDNA), and also provide me testable predictions on DNA function. Predictions you would be willing to put in print and test in the lab.

As I said, you already discount already-confirmed predictions, and instead seem to be trying to punt the issue several years in the future when you imagine these predictions might be tested.

[glipsnort (Steve Schaffner)]

@SFT

Initial created nuclear DNA heterozygosity followed by post-flood and post-Babel mutations can easily explain the data.

Still can’t explain the frequency spectrum of human genetic variation.

[CrisprCAS9]

@T_aquaticus

The problem is that you can’t have all the variants in one allele. Many of these variants are rare, and they are found separately from one another. If they are on one contiguous stretch of DNA they will travel together, but that’s not what we see.

That is, however, exactly what he believes happens. He thinks that you are getting rampant sub-kilobase scale recombination inside coding regions. I’ve tried to explain that recombination doesn’t work that way, he rejects the correction.

[SFT]

@CrisprCAS9

That is, however, exactly what he believes happens. He thinks that you are getting rampant sub-kilobase scale recombination inside coding regions. I’ve tried to explain that recombination doesn’t work that way, he rejects the correction.

I’ve addressed this numerous times. For one, we know gene conversion can help with this. And secondly, and the most obvious answer from a created heterozygosity starting point,

“these designed variants would be expected to be created within useful linkage groups, and would have originated at high allelic frequencies.”

[SFT]

@glipsnort

Still can’t explain the frequency spectrum of human genetic variation.

Did you read the paper I cited earlier?

"In this paper we have used logic and numerical simulation to
show that there are several Designed Diversity mechanisms that
can reconcile a literal Adam and Eve with the allele frequency
distribution now seen in the human population. These genetic
mechanisms include: 1) designed diversity within Adam and
Eve’s four sets of chromosomes followed by accelerated genetic
drift associated with multiple population constrictions; 2) as
above, combined with more powerful demographic forces such
as selective sweeps, lineage extinctions, and differential subpopulation expansions; and 3) designed diversity within Adam
and Eve’s originally created gametogonia. Together, these various
genetic mechanisms seem to falsify the claim that there is “no way”
that two people could give rise to the human allele distribution that
we see today. The designed gametes model appears to be especially
robust, and in our opinion is even elegant. It seems to be the best
explanation for how Adam and Eve might have simultaneously
given rise to our current human allele patterns and our current
linkage patterns. Future research will examine the concept of
“demographic stirring” and how it may accelerate genetic drift.
Given the premise of a miraculously created Adam and Eve, the
most coherent, powerful, and compelling explanation for most of
the genetic diversity found within the human race is “designed
diversity”. This is especially true when we consider the various
forms of human beauty and the various forms of human gifts and
talents. Human traits of this type cannot rationally be attributed
to Darwinian mutation/selection. In addition, designed diversity
appears to have enabled rapid human adaptation after the flood. "

http://creationicc.org/2018_papers/20%20Sanford%20et%20al%20Adam%20and%20Eve%20final.pdf

[T.j_Runyon]

@SFT

This is especially true when we consider the various
forms of human beauty and the various forms of human gifts and
talents. Human traits of this type cannot rationally be attributed
to Darwinian mutation/selection.

First off, what is human beauty? And describe some talents that can’t be attributed. If I had to guess you are completely unaware of the literature in fields such as:

Paleoneurology

Evolutionary developmental psychology

Evolutionary anthropology

Cultural evolution

Human behavioral ecology

Evolutionary psychology

Human behavioral genetics.

If you and the author of that paper were, you would know that many behaviors can be attributed to selection, and even some
Behavioral traits aren’t believed to be adaptive.

Im aware this is a little off topic so feel free to split.

[CrisprCAS9]

@SFT

For one, we know gene conversion can help with this.

Gene conversion makes it worse for you, not better.

@SFT

“these designed variants would be expected to be created within useful linkage groups, and would have originated at high allelic frequencies.”

This is obviously impossible and self-contradictory nonsense. If they are within linkage groups, then they don’t separate which your model requires. And there aren’t enough linkage groups to account for the level of diversity you need to explain anyway (while amusingly also being too many to be producible in your limited time span).

[CrisprCAS9]

@SFT

Reread what I said and try again.

Okay, I reread it and what you said is still wrong for exactly the reasons I stated in my previous comment. Do you have an actual argument?

[Timothy_Horton]

@SFT

. I think this discussion speaks for itself as to who is presenting the data and who is providing smokescreen and incredible dodgeball skills.

It sure does but not in the way you think. Your smokescreen and dodging skills are second to none. I’ll note in passing you completely dodged the mt genomic analysis for the 300K year old hominin I provided. But that’s OK, no one expected you to do anything besides run from the data presented.

[Timothy_Horton]

@SFT

That was a sad insufficient response. I expected more from somebody as intelligent as you. O well. Reread what I said and try again.

“I already answered, go read again” seems to be your favorite dodge. You use it in almost every post where you are ducking the tough questions and data provided.

[Timothy_Horton]

@SFT

Given the premise of a miraculously created Adam and Eve, the
most coherent, powerful, and compelling explanation for most of
the genetic diversity found within the human race is “designed
diversity”.

LOL! That’s brilliant. The YEC explanation for why we see way more genetic diversity than 2 people only 6000 years ago could possibly carry is “GOD DID IT BY A MIRACLE!”. Now all you have to do is explain why God used a miracle to make it look exactly like natural evolutionary processes operating over million of years created the diversity.

[Roy (30-year veteran)]

@SFT

I’ve addressed this numerous times. For one, we know gene conversion can help with this. And secondly, and the most obvious answer from a created heterozygosity starting point,

“these designed variants would be expected to be created within useful linkage groups, and would have originated at high allelic frequencies.”

How can a variant have “originated at high allelic frequencies” when there were originally only 4 genomes and they were heterozygous? Surely every allele starts with a frequency of 25%.

[dsterncardinale]

@SFT

These genetic
mechanisms include: 1) designed diversity within Adam and
Eve’s four sets of chromosomes followed by accelerated genetic
drift associated with multiple population constrictions

@SFT, just want to hit pause right there. Can you describe how genetic drift affects allelic diversity?

[Dan_Eastwood]

@dsterncardinale

Hi all, just want to chime in since I’m the aforementioned “Dr. Dan”.

Hello Dr. D! And welcome to the forum

@Roy

In theory there is a maximum possible four nucleotides at each locus, and Adam/Eve between them could have all four since they have a total of four genomes. Thus all existing alleles can be generated by recombination. This doesn’t work for the Y chromosome or mDNA, obviously, but that’s a technical detail that can be ignored.

[quoting Roy, but my question is general.]

There are examples where an individual could have more than 2 alleles, such as XYY syndrome. Given that XYY is a relatively mild genetic disorder, what would be likely consequences of more than 4 alleles? More than 10?

My intuition: there is a good reason that extra genes are considered to be genetic disorders, and I suspect high numbers of alleles (more than 6??) is probably fatal, if not biologically impossible. I would ask biologists to weigh-in, but I’m not sure this even qualifies as biology - it seems more like science-fiction.

Welcome @CrisprCAS9 too!

@SFT

These questions:
…
have all been answered.
[link to article]

I can’t help but remark on this paper:

Results
Figure 2 displays the allele frequency data for several
model populations, averaged over 100 model runs (only 10 runs for n = 50,000). Population sizes were: a) 500, b) 1,000, c) 5,000, d) 50,000. A Flood-type bottleneck with random DILs occurred at year 1,600. The two wings that appear in later years among the smaller populations represent alleles that drifted to fixation (0% or 100%). There was almost no noticeable difference between the populations with 5,000 to 50,000 individuals, meaning we successfully captured the size range required to draw conclusions about any larger population size.

My emphasis added. Reformatting was necessary to correctly copy the text.

BUT “no noticeable difference”? That’s it?? Just look at the fuzzy Excel plots??? No statistics or tests??? This method of comparison is subjective and unreliable.

I also note that a range of program parameters is given, but no appendix table indicating which parameter sets relate to specific conclusions.

[T_aquaticus]

@SFT

Together, these various
genetic mechanisms seem to falsify the claim that there is “no way”
that two people could give rise to the human allele distribution that
we see today.

All you have done is invent mechanisms that are operating at rates orders of magnitude higher than they have ever been observed to operate at. It is 100% ad hoc rescues where you invent rates and processes for the sole purpose of getting the conclusion you want.

Just for fun, here is a 60 bp (20 codon) open reading frame:

atgcatgcactatgtcgtcaattgtctggtcccttcatcactttagaaccaaatgcgtga

Per your model, I changed the base at each position in 3 copies so that we have all possible bases in 4 sequences.

atgcatgcactatgtcgtcaattgtctggtcccttcatcactttagaaccaaatgcgtga

atggtacgagctaaaccagatgagggtacgagagcattgcgcgatctatcatcactatga

atgtccatatgccggcactacaggattcaattgaagcttgagaggggagtactgtattga

atgagggaaaaggccctgaagccgcatttcgatcgtgtattacccacaaaaggcagctga

I may have missed a few bases, but most of the changes are there. I also had to change a few back to avoid stop codons. When I compare them there isn’t much similarity at all. Is that what we find with modern alleles? Are they almost completely different for each gene? Nope.

It gets even worse for the protein sequence :

>1

MHALCRQLSGPFITLEPNA

>2

MVRAKPDEGTRALRDLSSL

>3

MSICRHYRIQLKLERGVLY

>4

MREKALKPHFDRVLPTKGS

All of the protein sequences are completely different from each other. How could these proteins have the same function with almost every amino acid changed?

How in the world is this supposed to work?