You need a vocalization or clicking system - that is already there. You need a system for hearing - that is already there as well. But really, the whole analog of machines to biological function and technological development to phylogeny, in my mind, is nothing but a big distraction. While mechanical systems are sometimes used to test ideas about biological mechanics, in general question concerning biology are addressed by studying biology.
The echolocation abilities of bats are not separate from the vocalizations and auditory systems common to mammals, incorporating vocal cords or tongue clicks, larger cochlea, and specialized neural processing. As well, bats generally have fine vision which works together with echolocation for finding prey. Every element of echolocation was adapted from existing components.
As a side note, as AiG and other YEC organizations like to appeal to bat echolocation as an example of a wondrous system which can only be explained by divine creation, I must point out that it exists for the express purpose of predation (although insects don’t seem to count).
i dont think that we can get a sonar just by small changes in existing parts but even if it was possible it should need at least several mutations at specific genes (say genes that are related to heahring).
so lets assume that we need hearing system. we will need at least a part that can detect sound wave, a connection to the brain or other processor and a system that can process it. so we will need at least 3 parts for minimal hearing.
No it doesn’t. It seems I have to repeat my previous post, as you don’t appear to have understood the concept of significance. You can have a significant match without having an exact match. Do you understand?
It would be trivial to find data sets where less than 1 in every 200 data points match exactly, and yet the two data sets still are remarkably similar and corroborate each other.
To say that a certain pattern is present in some data, like a nested hierarchy, does not mean every single data point, nor even that the majority of the data points, need to reflect the hierarchy. You can have a significant level of nesting hierarchical structure in a data set where most data points show little to no hierarchy. In the same way that you can have significant mutual corroboration by multiple independent thermometer measurements, with no two thermometers measuring the exact same value.
You have to try to understand this concept.
Yeah, that there should be a significant amount of nesting hierarchical structure in the data.
No, it doesn’t actually predict a perfect pattern. There is such a thing as homoplasy, there is such a thing as secondary loss, as in reversion, there is extinction of species that never leave fossils, and then there is the process of fossilization itself where some times the character of interest simply isn’t preserved. All of these processes will scramble the historical pattern, so you would basically never expect to have a perfect nested hierarchy.
How well is the fit? This is exactly the crucial question. What is the degree of fit? If you include more species and if you pick a significant(again a crucial term) number of characters instead of just one, does the degree of hierarchical structure improve with more data?
Which you have not even begun to show is at all a problem.
This seems so easy to counter that I don’t think you have really thought this through. From an evolutionary perspective, which senses do you think would have evolved before others? touch/pressure, heat/cold, hearing/sound, light/vision, “smell” (chemical sensitivity).
Since phylogenetic trees generally aren’t based on single characters, but instead large collections of them, it is pretty much completely irrelevant how many cases of characters with little to no hierarchy you can find.
I can do that myself. I can find shared similar DNA sequences for substantial numbers of species where most characters in the sequence aren’t phylogenetically informative at all, either because the signal is obscured by too much noise, or because they’re completely identical.
Consider this simple hypothetical scenario:
Species 1: CAAATCAAGTACCGATACGTCGACCGA
Species 2: CAAATCAAGTACCGATACGTCGACCGT
Species 3: GTAATCAAGTACCGATACGTCGACCGC
Species 4: GCAATCAAGTACCGATACGTCGACCGG
Most characters in this data set are completely identical, there is thus zero hierarchical structure in them(they do not imply any differences in how they each are related to each other). The last character is different for all four species, which unless you have some model that says certain substitutions are more likely than others, also implies no hierarchical information. So without a substitution model, only the first two characters have hierarchical information. Hence even in a situation where the vast majority of characters show no hierarchical structure, we can still derive a phylogeny.
We could then further corroborate (or possibly contradict) the phylogeny by including more data. If multiple independent data sets, be they collections of morphological characters or more genetic data, imply a similar phylogeny, then we have consilience of independent phylogenies. And what is a good explanation for that? That’s right, common descent.
Examples of just this abound in nature. Sound is the motion of molecules. Even single cell animals can sense their environment. Some plants even respond to physical stimulation.
Have you never considered this? To me it seems barely credible that you have not, but then I spend a lot of time on such thoughts, and maybe you have not?
@Rumraket: Small quibble: using parsimony as the criterion, only the first site is phylogenetically informative. The second can evolve with 2 changes, no matter what the tree is.
i actually do talking about the majority of traits and not just a single one or few. to show that i can just pick up a specific trait randomly and test it. then i can take another one randomly and see if i got similar result. in this way we only need few examples since we take them randomly and thus they represent the rule and not the exceptional. do you agree? because if so this is what i did with my examples above.
yes. and they do that because they have complex systems to do that. this is my whole point: we need a complex system for hearing or to smell etc. so if the first part that can detect sound wave evolved. what was the function of it without any special connection or a process that can use it?
Did you not see my comment about single cell creatures? It doesn’t get much simpler than that. I gave you examples that meet your criteria, and now you move the goalposts.