If Design will not produce the same hierarchial structure as that seen in life, then Design can not be used as an explanation for that pattern. However, evolutionary mechanisms will produce a noisy nested hierarchy. Evolution and common descent can explain the pattern.
You haven’t shown any branching structure.
This is false. Different design cannot make the same hierarchal structure. This is not evidence against design just evidence for a different design then we have seen before. The evidence is that design creates a hierarchal structure and is a possible explanation for the hierarchal structure we see in life.
You have a much bigger problem with your claim and that is explaining the differences. Common descent that we observe like human common descent does not display significant differences in morphology and gene type.
Nice chatting today. Although we disagree I think you make solid arguments. Out until tonight.
This is really confusing. Will Design produce a nested hierarchy or not? If Design does produce a nested hierarchy, then show us the tree for Mac computers and the features you used on each branch to build that tree. If Design does not produce a nested hierarchy, then it can’t explain why life fits into a nested hierarchy. It is really that simple.
For life, there aren’t wildly different trees for different designs. You can take almost any feature and it will produce the same trees, within the limits of the expected noise produced by other biological mechanisms. We don’t find half bird, half mammal species. We don’t see fur haphazardly spread around to different species. We see all of these traits falling into similar trees.
If one or many intelligent beings did design life as separately designed groups then why would you expect them to fall into a tree-like pattern? I could design an organism with a mixture of features from fish, birds, mammals, and dinosaurs if I wanted. There is no reason that I couldn’t. There is no reason that if I chose to have a species with three middle ear bones that I would also be forced to give it mammary glands or tidal lungs. There is no design reason why these adaptations always have to be together. However, there is an evolutionary reason.
I am not sure what you mean by this.
Added in edit:
I quoted from George Romanes in another thread, and it applies to this one as well. Here is some food for thought:
Awesome, I was thinking that you would be in favor of all kinds of scientific pursuits!
I have already explained this base of the tree is the apple 2 split is the original Lisa computer and the Next computer. Next computer splits into the desk top mac and the laptop mac. The Lisa splits into the original mac desk top and the mac laptop. A nested hierarchy where the earlier generation has differences that converge at later generations. There are similarities and differences that converge.
They are not for the macs either.
Same with macs. Software and hardware trees will create the same tree.
Conversation of resources creates the tree.
Evolution (common descent) does not explain new features. The best example you came up with to demonstrate an adaption was a broken sequence that serendipitously worked in a hostile environment.
Restated: Common ancestry explain similarities but not morphological differences.
This made me laugh! Thank you.
@T_Aquaticist
Nicely stated!
George, I’m replying to the @T_aquaticus quote, not you, but couldn’t find the source! Apologies.
There was a whole thread here on the messiness of nested heirarchies, based on the paper by Winston Ewert. Joshua agreed that this messiness is the case, but considered it a prediction of neutral theory, whilst Winston is looking at a design explanation.
Either way, messy trees are a fact, and the real situation is that biological nested hierarchies frequently do display anomalous features falling outside the tree-like pattern. To say that “the designer” would make them more anomalous is a purely subjective theological judgement (a theological premise in a non-design argument, to cite the thread title). The reply could easily be made that evolution ought to make them less anomalous. The fact is that they are imperfect, which allows either explanation at this stage of knowledge.
But the deviations in nested hierarchies are significant and suggest far from simple evolutionary pathways. For example, the recent discovery of a fossil turtle more or less clinching turtles’ diapsid origins comes only after a century or more of doubt, because of profound anomalies in the fossils (see Turtles as Hopeful Monsters. )
But in order for this fossil to settle the matter, it is necessary that turtles lost teeth and developed beaks, then lost beaks and re-developed teeth, and then re-evolved beaks, at least once or maybe more. Louis Dollo would not be impressed - and it’s still implausible under current evolutionary theory, though T-Aquaticus’s hypothetical mix ‘n’ match designer would account for it just fine.
And to reiterate what I’ve said at BioLogos many times, nested hierarchies were first proposed in biology by the likes of Linnaeus as evidence of common design, without evolution, under the longstanding principle of plenitude. Linnaeus would, on his principles, dismiss the idea that God would mix features arbitrarily.
Creating a tree with any designed product is not very difficult. For example take vehicles.
The tree would start with drive, bifurcating into two self/animal driven and auto driven.
Auto driven would bifurcate into thre electric motor driven, internal combustion engine and hybrids.
ICE engine vehicles would then be seperated based on kind of fuels used. For example diesel, petrol etc…
You would get a tree with cleared nested clades. Any similarities in between can be explained by a combination of common features (analogous to common descent) and special feature depending on performance requirements (this would be analogous to convergence).
When we go into details, the nested clades will prove to be imperfect. The same can be observed for nature also.
The point is that it could go either way. A designer could create life according to a very strict tree-like pattern or without any tree-like pattern. Therefore, a tree-like pattern, even a messy one, is not a prediction of Intelligent Design.
The difficulties become even greater when you move to the level of genetics. If we are using a model of separately created kinds then how does one explain the pattern of divergence in geneomes, not just of coding or functional DNA but the non-functional DNA like introns and ERVs? Why would a designer create more differences in introns than in exons? Why would a designer make more synonymous mutations? Why change the long tandem repeats within ERVs to make them reflect the tree based on morphology?
How do turtles deviate from a nested hierarchy?
That’s not a significant deviation from a nested hierarchy. Significant deviations are where you see adaptations from distantly related species. For turtles, that would be something like fur or feathers.
I would argue that the mixtures of features in modern species is arbitrary.
With that tree in mind, it is rather easy to find numerous violations. For example, you could find the same tire on a hybrid and diesel car, but two different tires on the same model of hybrid car. You could find the same radio in an electric and gasoline driven car, but two different radios in the same model of gasoline car. Your tree needs to work with the other features in cars, and it doesn’t.
We don’t find nearly the same level of noise in life as we do with designed things.
The explanation requires actual features which you didn’t list. Until you list the features that the branches are based on you don’t have a tree.
Then show us the tree with the methods you used to construct the tree and the features you used.
How do the genetic differences between species not explain the difference in morphology between them?
That makes no sense. Evolution is descent with modification. Change is right there in the definition.
You would find such similarities in nature also… like wings in bats and birds… eyes in all sorts of organisms, ears in organisms, legs etc. You can think of it as convergence. Besides the radio for electric cars and gasoline cars will not be identical.
This kind of tree and that found in nature is of the same category.
And all of those fall into the same tree as other features. For example, the bird and bat wings are very different and are specific to the lineage they are found in. You don’t find species with feathers and bat-style wing nor do you find species with fur and a bird-style wing.
You can go to any radio shop and get the same radio put into nearly any car you want.
The branches are based on known ancestral relationships. The observed features of software and hardware are more similar at each branching level.
This is not what I was discussing. We don’t know the cause of the morphological change. If it is driven by genetic change we don’t know the cause of those changes.
This I agree with. Evolution is not explained by common ancestry alone. You need to explain how the modifications occurred. This requires functional information who’s origin is unknown.
Still no features listed.
We do know the causes of genetic change. They include substitution mutations, genetic recombination, insertion, deletion, transposon activity, and other mechanisms.
You have never shown that functional information actually exists in the genome.
No, you don’t know the causes you know some of the causes. You don’t know the causes that lead to new features.
This is generally accepted and is evidenced by the coding of proteins by DNA. Do you deny the reality of transcription and translation? Do you deny that the information in DNA is largely responsibly for a zygote to become a human? Do you deny that protein function is determined by its AA sequence?
Examples of features are original mac os, mac objective c os. Motorola processors, Intel processors, attached display and keyboard etc.
You seem to be confusing two things: mechanisms and history. We do know of many mechanisms that produce genetic change, and the differences in genomes are consistent with those mechanisms. What we may not know is the exact history of how those mechanisms played out in the past. That doesn’t change the fact that we know how genetic changes take place.
I deny that you can empirically measure functional information in any DNA sequence. If you can’t measure functional information then you have no way of knowing if it has increased or decreased. If you want, you can prove me wrong by measuring the functional information in this DNA sequence:
CCAGAAGCCGAACTGGGCCAGACAACCCGGCGCTAACGCACTCAAAGCCGGGACGCGACGCGACATATCGGCTAAGAGTAGGCCGGGAGTGTAGACCTTTGGGGTTGAATAAATCTGTCGTAGTAACCGGCTTCAACGACCCGTACAGGTGGCACTTCAGGAGGGGCCCGCAGGGAGGAAGTTTTCTGCTATTCGTGGCCGTTCGTGGTAACTAGTTGCGTTCCTAGCCACTACAATTGTTTCTAAGCCGTGTAATGAGAACAACCACACCATAGCGAATTGATGCGCCGCCTCGGAATACCGTTTTGGCAACCCCTTACTAAGGCCATCGCGATTTTCAGGTATCGTGCATGTAGGGTTGGACCGCACGCATGTTAAACTGCTGGCGAACCGCGATTCCACGACCGGTGCACGATTTAATTACGCCGACGTGACGACATTCCTGCTAATGCCTCACCCGCCGGACCGCCCTCGTGATGGGGTAGCTGGGCATGACCTTG
So how do they fit into the tree? What methods did you use to compare the software to form your tree?