The very first reference itself answers your question. It reported:
“Because clinical resistance typically requires three to five independent mutations the data imply that in the absence of efficient LexA cleavage, E. coli would evolve clinical resistance at least 10^6 -fold slower.”
Compared to traditional mutation models, Stress-induced mutagenesis (SIM) models better fixes the problem of evolving complex adaptations. (Complex adaptations refers to adaptations that depend on the fixation of multiple, specific mutations, where intermediate stages of evolution seemingly provide little or no benefit. Complex adaptations are pervasive in molecular systems).
For example, a 2014 theoretical study reported: “Our results suggest that SIM can help resolve the problem of fitness valley crossing by reducing the time required for a population to shift an adaptive peak.”
The paper added:
“Our results show that SIM increases the rate of complex adaptation…”
(https://doi.org/10.1098/rspb.2014.1025)
■ An important thing to consider along with this is that living systems are equipped with molecular chaperones. These chaperones are able to alleviate or buffer the deleterious effects of mutations and stabilize proteins. This built-in feature promotes evolution.
Conversely, the first hypothetical self-replicating system would obviously lack such molecular chaperones to buffer against deleterious mutations.
■ Comparing evolution driven by plasticity and traditional mechanism, a 2010 paper stated:
“In contrast to the rapid response produced by plasticity, if the production of newly favored phenotypes requires new mutations, the waiting time for such mutations can be prohibitively long and the probability of subsequent loss through drift can be high”
(https://doi.org/10.1016/j.tree.2010.05.006)
FYI, its called Digital Object Identifier or DOI. All one need to do is copy paste the doi in a browser. The doi has been provided right under the quotation.
Where did you get this incomplete description from? The first place a sensible person would look is the university staff profile page. The very first sentence says:
“Sonia E. Sultan is a plant evolutionary ecologist.”
(Sonia Sultan - Faculty, Wesleyan University)
By the purposeful arrangement of cell’s building units.
When?
That can be answered when we discover the age of first cellular life form.
Who?
Cannot infer from biology alone and I don’t wish to speak outside of it in this thread. Maybe in another thread.
Essential genes involved in the synthesis and processing of macromolecules alone constitute more than 300 genes. Along with DNA, cell simultaneously needs proteins & rna molecules to process the information in the former. This is universal to all cellular life forms that is known to us. Based on this information, we can only make informed guesses on the complexity of first cellular life.
As you might have already noticed, the only thing I argued against is the purported creative power of random accidental mutations plus fixation in forming the first cellular life. Could this particular mechanism be compared with that of bird’s and beever’s design? Lets compare both. ︎ We observe in real-time these animals successfully designing nest/dam. Nobody would challenge an observable fact. What about the purported creative power of the aforementioned mechanism of evolution? Zero emperical evidence exists for the later claim. ︎ Even if these animals fail in their “trial and error” attempts, we need to keep in mind that they are intentionally arranging the individual components with an end goal in their minds i.e to build nest/dam (In fact, this is the reason I consider them as designs). What about the aforementioned mechanism of evolution? Neither intention nor end goals.
In the biological context, specified information refers to sequential information that specifies a biological function. Thats why design literatures use “specified” and “functional” in an interchangeable manner.
For example, the following DNA sequence specifies an e-coli strain’s tRNA.
If you have problem with the term “specified”, you can use the word “functional” instead. Problem solved.
You’ve got to be kidding. I have written "specified or functional" two times in that para and the nature article explicitly uses the later term. It’s as simple as that.
You are right in saying that designer could act in any manner. But the million dollar question is do we know of any evolutionary mechanism that have the potential to mimick the action of designer i.e power to generate large amount of biological information required for the first cellular life to sustain? The “identical to- and indistinguishable” argument put forwarded by you becomes valid only when such a mechanism is discovered.
Note that my premises and conclusion of Intelligent Design (which I posted as a reply to Roy) were based on the origin of first cellular life. It can be falsified if someone is able to prove that functional biological information required for a cellular life to sustain could be generated solely through a particular evolutionary mechanism - Selection/Drift acting on random accidental mutations. In case I missed any other possible mechanisms, you can point it out.
As I described earlier, all the built-in cellular mechanisms would be absent in the hypothetical evolutionary pathway between first self-replicating system and first cellular life.
That doesn’t contradict what I wrote. Please read for comprehension.
What I wrote was: “When it repairs damaged DNA, mutations are randomly created as an unavoidable byproduct . Those are mutations, they’re random, and they have to get fixed by drift and selection.”
When it repairs damaged DNA. It is an unavoidable byproduct of the repairing of damaged DNA.
I did not say the SOS response creates mutations as an unavoidable byproduct during genome replication.
So the study you quote says: “Thus, our results indicate that the mutations that confer resistance to ciprofloxacin and rifampicin are not simply the result of unavoidable errors accumulated during genome replication, but rather are induced via the derepression of genes whose protein products act to significantly increase mutation rates”
Rates. The SOS response increases the mutation rate. Which then essentially guaranteed that the antibiotic-resistance conferring mutations would be found in the allotted time for the experiment.
Do you fathom this elementary concept? The time component? In X number of weeks, the “background” rate of mutation is not high enough to guarantee that antibiotic resistance conferring mutations are found.
With the SOS response activated, the mutation RATE is increased. So now in that same X number of weeks, antibiotic resistance conferring mutations are found.
So the FREQUENCY of mutations increased, and that ensured those low-odds mutations were produced in a short span of time. The dice were rolled more in the same amount of time. That is why the lucky combination was found.
Those mutations were no less random. The dice throws were still random. They were just thrown more times in the same span of time.
Do you understand?
So the induction of the SOS response, which is normally repressed because it would result in a net increase in mutations, which would probably lead to an increased mutational load, results in a higher RATE of mutations.
In this experiment, during this higher rate of mutation accumulation with an active SOS response, there were lucky individuals who suffered mutations that gave antibiotic resistance. Mutations that apparently did not occur in the same span of time when the SOS response was not activated. That implies those antibiotic-resistance conferring mutations are rather rare so they have a low chance of occurring in the short span of time in which the experiment was performed.
Do you follow?
The mutations generated by the SOS response are still randomly created. The majority do not result in the adaptation in question. The proteins that act to repair the broken DNA, and which incorrectly fill in bases in damanged parts, do not somehow know beforehand what mutation is going to result in a fitness increase. The majority of the bacteria do not gain the adaptive mutation. They isolate rare individuals out of a whole population of bacteria with active SOS responses. The vast, vast majority of those bacteria with active SOS responses die because they too fail to produce the mutations that gives resistance. The fact that the RATE of mutation was increased by the activation of these genes that generates lots of mutations does not make those mutations non-random.
Get it?
Thank you, that totally supports what I said. Completely and thoroughly. The activated SOS response simply increases the RATE of mutations. It does not make mutations happen that would not or could not happen otherwise given enough time. It just ensured that, when active in that experiment, the short time during which it was performed was enough to produce the rare combination of mutations of interest.
All those mutations created when the RATE was increased were all still random. It was merely the fact that the RATE was increased that guaranteed the result in that limited amount of time.
So, I now return to my question: WHAT IS THE RATE AT WHICH MUTATIONS CROSS OVER FROM RANDOM TO NON-RANDOM?
First of all your conclusion contains concepts not defined in any of your premises. Such as criteria for what constitutes a rational explanation, or how to evaluate whether one is more or less rational than another, and there is no comparative evaluation of this degree in the two proposed competing explanations.
Since your conclusion describes concepts not found in the premises, the conclusion can’t logically follow from those premises.
Suppose I make this argument:
Premise one: Oranges are sour.
Premise two: Bananas are sweet.
Conclusion: Therefore bananas are longer than oranges.
That conclusion doesn’t follow from those premises. The conclusion may be true, but those premises do not lead to that conclusion, because there’s nothing about weight in the premises.
Your argument suffers this exact problem. It has other problems too.
Another problem is your argument says “large amounts of functional information necessary to produce the first cell.”
Please inform us how much functional information is necessary to produce the first cell and how you know the cell you describe is, or must be, the first cell? How could you possibly know that?
Yet another problem with your argument, this one the worst of them, is that it is a textbook appeal to ignorance. A basic fallacy in logic. The argument besides being obviously invalid, also commits a basic fallacy. The quintessential God of the gaps fallacy: appeal to ignorance. You are quite explicitly appealing to our ignorance in premise two.
Premise Two: No materialistic causes have been discovered with the power to produce large amounts of functional information necessary to produce the first cell.
Even assuming it is true that no such cause have been found doesn’t mean there isn’t one.
Because we have yet to find X, and because you can imagine Z, you say it is most rational to explain Y with Z. So you are appealing to ignorance in your argument. Our lack of knowledge is a premise in your argument.
Sorry to hear you don’t understand how logic, argument, conversation, or language works. You should probably brush up on those before posting additional comments.
I expect you read enough to correct your ignorance regarding things that are well already well understood. But I guess that is unreasonable of me.|
So you can’t answer that question, yet remain convinced that “design” is the answer.
And yet you conclude from your ignorance of the specific steps by which evolution has produced some specific aspects of biology that evolution did not produce them.
That is meaningless - not a scientific question - until you have a Designer that can be falsified. WE first require a falsifiable hypothesis about the information the alleged Design can create. Then, and only then, can we make comparisons to biological (or pre-biological) mechanisms.
As to creating biological information, if we all agree to the same definition of information, then creating new information through random processes is not a difficulty.
OK. Let’s take a look at that …
No, not even in the Design literature. [Dembski (2005)](link: http://billdembski.com/documents/2005.06.Specification.pdf) proposed “Complex Specified Information”, which is a hopeless mistake. Even if we ignore all the errors, and that it cannot have any biological meaning, it implies that simple sequences like
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
are more complex than
GGGGCTATAGCTCAGCTGGGAGAGCGCTTGCATGGCATGCAAGAGGTCAGCGGTTCGATCCCGCTTAGCTCCACCA
which make no sense at all.
Functional Information is defined in Szostak (2003), which you already cited above. Go read this paper again (it’s very short) and understand that it is entirely difference from Specified Information in Dembski (2005), and does not have the sort of application you think it does.
I linked to articles about this is an earlier comment, in particular a post by @Joe_Felsenstein at Panda’s Thumb. Information theory is a difficult topic, and you may not understand it. I am a statistician, and Information Theory run parallel to statistical theory, so I have a strong understanding of the meaning and applications. I can try to help you understand, but first you need to acknowledge the error so we can progress.
Again, that’s just wrong.
think that you do not understand the terms you are using. If you want others to understand your argument, you need to be absolutely clear what you mean.
Science isn’t merely inference and studying end products. It’s about testing hypotheses. You’ve offered a testable one, but presented it falsely as a fact.
We observe the mechanisms of evolution in real time.
If you were approaching this scientifically, you’d be testing design hypotheses. Your “methodology” is simplistic pseudoscience.
If you’re a competent student, you should be able to figure out where to start.
You might want to focus on data instead of words. That’s how real scientists read scientific papers.
You didn’t address the data. Scientists using teleological and metaphorical language isn’t it.
That doesn’t address site specificity. You might bother to look up what the authors meant by “non-AID targeted genome.” Hint: AID affects a lot more of the genome than the Ig locus.
It did nothing of the sort. It looked at parts within Ig genes, not Ig genes versus the rest of the genome.
Again, you’ve stated a perfectly testable ID hypothesis inferred from sloppy writing (and your shallow reading), not any empirical fact. I agree that design should be site-specific, not merely selective.
Tests of that hypothesis would include:
randomly inserting a reporter in B-cell genomes to see if integration into the Ig locus (but no other loci) increases mutations detected using the reporter; and
adding Ig genes with reporters to see if they mutate while reporters lacking Ig sequences do not.
Analysis of mutations as they occur, not after they have been filtered by selection.
We have technologies that allow such analyses.
Do you think that such papers exist? You are only looking to support your position by rhetorical means, ignoring data.
Correct. In science, we call that a hypothesis. It’s even an ID hypothesis!
False. I asked if you had a Wikipedia-level understanding before claiming greater understanding than experts. You missed that point completely. It’s even pointed out, with some citations, in the introductory paragraph.
That you made it up, or more likely that you are regurgitating from someone else who made it up. You are pretending that science is like high-school debate and not about testing hypotheses.
I am explaining it to you. Have you considered learning more before pontificating? Have you considered looking at data instead of words?
It does, but that’s cell-type specificity, not site specificity.
But it isn’t; for it to evolve, it must merely help more than hurt. Start looking at data and stop looking at words.
How rare is it?
If it’s only primarily, it’s not specific. It’s merely selective. Your ID hypothesis is false.
What does “low” mean, quantitatively? Did you even look?
I mean that you are conflating very bad writing with data. Even if SHM was utterly site-specific, it has nothing to do with random mutations, as the mutations are still random with respect to fitness.
I see that you aren’t looking at data and pretending that science is like a high-school debate.
It is interesting that you claim to be able to read the minds of birds and beavers. How do you do that? Or are you just making assumptions.
Evolution is trial and error. The random mutations provide the trials. The natural selection decides which of those trials work well enough. It is the same kind of trial and error mechanism that you see in beavers, birds and throughout the biosphere. The one difference is that you are not making the same assumptions about evolution. Neither the beaver nor the bird care about the assumptions that you are making.
︎ We observe in real-time these animals successfully designing nest/dam. Nobody would challenge an observable fact. What about the purported creative power of the aforementioned mechanism of evolution? Zero emperical evidence exists for the later claim.